After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human GFRA2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GFRA2 cDNA Clone Product Information
RefSeq ORF Size:1395bp
cDNA Description:Full length Clone DNA of Homo sapiens GDNF family receptor alpha 2 with Flag tag.
Restriction Site:KpnI + XhoI (5.4kb + 1.45kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.


GFRA2 is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA2 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA/GDNFRa acts as the ligand-binding component. Experiments have improved that GFRA2 genetic variants and age may play a role in Tardive dyskinesia (TD) susceptibility, but further work is required to confirm these findings.

  • Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.
  • Souza RP, et al. (2010) Glial cell line-derived neurotrophic factor receptor alpha 2 (GFRA2) gene is associated with tardive dyskinesia. Psychopharmacology. 210(3): 347-54.
  • Vanhorne JB, et al. (2001) Cloning and characterization of the human GFRA2 locus and investigation of the gene in Hirschsprung disease. Hum Genet. 108(5): 409-15.
  • Size / Price
    Catalog: HG10331-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions