Quick Order

Text Size:AAA

Human ABHD14B Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ABHD14BcDNA Clone Product Information
Gene_bank_ref_id:BC007234
cDNA Size:633
cDNA Description:ORF Clone of Homo sapiens abhydrolase domain containing 14B DNA.
Gene Synonym:CIB
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human ABHD14B Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged on other vectors
Related Products
Product nameProduct name
Background

ABHD14B belongs to the AB hydrolase superfamily, ABHD14 family. It can be detected in spleen, thymus, prostate, testis, ovary, small intestine, colon, peripheral blood leukocyte, heart, placenta, lung, liver, skeletal muscle, pancreas and kidney. ABHD14B has hydrolase activity towards p-nitrophenyl butyrate (in vitro) and may interact with TAF1. It may activate transcription. Recombinant human ABHD14B protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. ABHD14B contains an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. In molecular biology, the alpha/beta hydrolase fold is common to a number of hydrolytic enzymes of widely differing phylogenetic origin and catalytic function. The Ab hydrolase domain containing gene subfamily is comprised of 15 mostly uncharacterized members.

References
  • Mehrle A, et al. (2006) The LIFEdb database in 2006. Nucleic Acids Res. 34:D415-8.
  • Wan D, et al. (2004) Large-scale cDNA transfection screening for genes related to cancer development and progression. Proc Natl Acad Sci. 101(44):15724-9.
  • Wiemann S, et al. (2004) From ORFeome to biology: a functional genomics pipeline. Genome Res. 14 (10B):2136-44.
  • Size / Price
    Catalog:HG13913-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"