Quick Order

Human DYDC2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DYDC2 cDNA Clone Product Information
Gene_bank_ref_id:BC007374
RefSeq ORF Size:534bp
cDNA Description:Full length Clone DNA of Homo sapiens DPY30 domain containing 2 with N terminal HA tag.
Gene Synonym:DYDC2
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

DPY30 domain containing 2 belongs to the dpy-30 family. Dumpy-30 family members act as determinants of male fertility and interaction partners of metal-responsive transcription factor 1 (MTF-1) in Drosophila. MTF-1 plays a key role in transition metal detoxification and homeostasis. It binds to metal response elements (MREs). Two candidate dMTF-1 interactors are related to the small regulatory protein Dumpy-30 (Dpy-30) of the worm C. elegans. Dpy-30 is the founding member of a protein family involved in chromatin modifications, notably histone methylation. Mutants affect mating type in yeast and male mating in C. elegans. As part of the MLL1/MLL complex, DPY30 domain containing 2 is involved in methylation and dimethylation at 'Lys-4' of histone H3. H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. DPY30 domain containing 2 may also play an indirect or direct role in endosomal transport.

References
  • 1. Deloukas P, et al. (2004) The DNA sequence and comparative analysis of human chromosome 10. Nature. 429(6990):375-81.
  • 2. Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • 3. Xin X, et al. (2009) Shifted Transversal Design smart-pooling for high coverage interactome mapping. Genome Res. 19(7):1262-9.
  • Size / Price
    Catalog: HG13911-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"