Quick Order

Text Size:AAA

Human BPI ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BPI cDNA Clone Product Information
Gene_bank_ref_id:BC040955
RefSeq ORF Size:1464bp
cDNA Description:Full length Clone DNA of Homo sapiens bactericidal/permeability-increasing protein with N terminal HA tag.
Gene Synonym:rBPI, BPIFD1
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Bactericidal/permeability-increasing protein is a member of the BPI/LBP/Plunc superfamily and BPI/LBP family. It is a cationic protein which can be detected in the azurophilic granule and on the surface of polymorphonuclear leukocytes. Bactericidal/permeability-increasing protein also is a lipopolysaccharide binding protein. It is associated with human neutrophil granules and has bactericidal activity on gram-negative organisms. Bactericidal/permeability-increasing protein contains two domains that adopt the same structural fold, even though they have little sequence similarity. It binds to and neutralises lipopolysaccharides from the outer membrane of Gram-negative bacteria. The cytotoxic action of bactericidal/permeability-increasing protein is limited to many species of Gram-negative bacteria; this specificity may be explained by a strong affinity of the very basic N-terminal half for the negatively charged lipopolysaccharides that are unique to the Gram-negative bacterial outer envelope.

References
  • G Schlag, et al. (1999) Protective effect of bactericidal/permeability-increasing protein (rBPI21) in baboon sepsis is related to its antibacterial, not antiendotoxin, properties. Annals of Surgery. 229(2): 262-71.
  • Michael Levin, et al. (2000) Recombinant bactericidal/permeability-increasing protein (rBPI21) as adjunctive treatment for children with severe meningococcal sepsis: a randomised trial. Lancet. 356 (9234):961-7.
  • Geraldine Canny, et al. (2002) Lipid mediator-induced expression of bactericidal/ permeability-increasing protein (BPI) in human mucosal epithelia. PNAS. 99(6):3902-7.
  • Elsbach, et al. (1998) The bactericidal/permeability-increasing protein (BPI) in antibacterial host defense (pdf). Journal of Leukocyte biology. 64(1):14-8.
  • Size / Price
    Catalog: HG13907-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"