After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SERPINA10 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SERPINA10 cDNA Clone Product Information
Gene_bank_ref_id:NM_007618.2
RefSeq ORF Size:1347bp
cDNA Description:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 with C terminal His tag.
Gene Synonym:PZI, ZPI, MGC25863, Serpina10
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Mouse protein Z-dependent protease inhibitor, also known as PZ-dependent protease inhibitor, SERPINA10 and ZPI, is a secreted protein which belongs to the serpin family. It is expressed by the liver and secreted in plasma. SERPINA10 / Serpin-A10 inhibits factor Xa activity in the presence of protein Z, calcium and phospholipid. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors).Over 1000 serpins have now been identified, these include 36 human proteins, as well as molecules in plants, fungi, bacteria, archaea and certain viruses. Serpins are the largest and most diverse family of protease inhibitors. Most serpins control proteolytic cascades, certain serpins do not inhibit enzymes, but instead perform diverse functions such as storage (ovalbumin, in egg white), hormone carriage proteins (thyroxine-binding globulin, cortisol-binding globulin) and tumor suppressor genes (maspin). Most inhibitory serpins target chymotrypsin-like serine proteases. These enzymes are defined by the presence of a nucleophilic serine residue in their catalytic site. Some serpins inhibit other classes of protease. A number of such serpins have been shown to target cysteine proteases. These enzymes differ from serine proteases in that they are defined by the presence of a nucleophilic cysteine residue, rather than a serine residue, in their catalytic site.

References
  • Han X, et al., 1998, Proc Natl Acad Sci. USA  95: 9250-5.
  • Han X, et al., 2000, Blood 96: 3049-55.
  • Irving JA, et al.,2000, Genome Res. 10 (12): 1845-64.
  • Irving J, et al.,2002, Mol Biol Evol. 19 (11): 1881-90.
  • Rawlings ND, et al.,2004, Biochem J. 378 (Pt 3): 705-16.
  • Water N, et al., 2004, Br J Haematol. 127:190-4.
  • Wei Z, et al., 2009, Blood 114 (17): 3662-7.
  • Whisstock JC, et al.,2010, J Biol Chem. 285 (32): 24307-12.
  • Size / Price
    Catalog: MG50315-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"