After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PLS3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
PLS3cDNA Clone Product Information
Gene Bank Ref.ID:BC039049
cDNA Size:1893
cDNA Description:ORF Clone of Homo sapiens plastin 3 DNA.
Gene Synonym:T-plastin
Species:Human
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

PLS3, also known as plastin 3, belongs to the plastin family. Members of this family are actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. There are two ubiquitous plastin isoforms in humans: L and T. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). PLS3 contains 2 actin-binding domains, 4 CH (calponin-homology) domains and 2 EF-hand domains. It is expressed in a variety of organs, including muscle, brain, uterus and esophagus.

Reference
  • Lin CS. et al., 1993, J Biol Chem 268 (4): 2781-92.
  • Goldstein D. et al., 1985, Cancer Res. 45 (2): 5643-7.
  • Arpin M. et al., 1995, J Cell Biol. 127 (2): 1995-2008.
  • Size / Price
    Catalog:HG15042-CY
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availsability:2-3 weeks
    Images
      Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"