Quick Order

Mouse ALDH4A1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ALDH4A1 cDNA Clone Product Information
Gene_bank_ref_id:NM_175438.4
RefSeq ORF Size:1689bp
cDNA Description:Full length Clone DNA of Mus musculus aldehyde dehydrogenase 4 family, member A1 with N terminal Myc tag.
Gene Synonym:Ahd1, P5cd, Ahd-1, Aldh4, P5cdh, Ssdh1, P5cdhl, P5cdhs, Aldh5a1, E330022C09, A930035F14Rik
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ALDH4A1 is a member of the aldehyde dehydrogenase family. Aldehyde dehydrogenase enzymes function in the metabolism of many molecules including certain fats (cholesterol and other fatty acids) and protein building blocks (amino acids). Additional aldehyde dehydrogenase enzymes detoxify external substances, such as alcohol and pollutants, and internal substances, such as toxins that are formed within cells. ALDH4A1 is expressed abundantly in liver followed by skeletal muscle, kidney, heart, brain, placenta, lung and pancreas. It is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Defects in ALDH4A1 are the cause of hyperprolinemia type 2 (HP-2). HP-2 is characterized by the accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. The disorder may be causally related to neurologic manifestations, including seizures and mental retardation.

References
  • Goodman SI, et al. (1974) Defective hydroxyproline metabolism in type II hyperprolinemia. Biochemical medicine. 10 (4): 329-36.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138 (1-2): 171-4.
  • Vasiliou V, et al. (2005) Analysis and update of the human aldehyde dehydrogenase (ALDH) gene family. Hum Genomics. 2 (2): 138-43.
  • Size / Price
    Catalog: MG51319-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"