Quick Order

Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KYNUcDNA Clone Product Information
cDNA Size:1398
cDNA Description:ORF Clone of Mus musculus kynureninase (L-kynurenine hydrolase) DNA.
Gene Synonym:4432411A05Rik, kynureninase
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50310-ACG$325
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50310-ACR$325
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50310-ANG$325
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50310-ANR$325
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50310-CF$295
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50310-CH$295
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50310-CM$295
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50310-CY$295
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone)MG50310-M$95
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50310-NF$295
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50310-NH$295
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50310-NM$295
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50310-NY$295
Mouse KYNU / Kynureninase Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50310-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
  • Lima S, et al. (2007) Crystal structure of Homo sapiens kynureninase. Biochemistry. 46(10): 2735-44.
  • Momany C, et al. (2004) Three-dimensional structure of kynureninase from Pseudomonas fluorescens. Biochemistry. 43(5): 1193-203.
  • Toma S, et al. (1997) Cloning and recombinant expression of rat and human kynureninase. FEBS Lett. 408(1): 5-10.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items