Quick Order

Mouse GABARAPL1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse GABARAPL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_020590.4
RefSeq ORF Size:354bp
cDNA Description:Full length Clone DNA of Mus musculus gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1 with N terminal Flag tag.
Gene Synonym:GECI; Apg8l; Atg8l; AI196471; MNCb-0091; 3110025G09Rik; 9130422N19Rik
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

ATG8, also known as GABARAPL1, is a ubiquitin-like protein which has a crystal structure. ATG8 consists of a 5-stranded β-sheet, which is enclosed by two α-helices at one side and one α-helix at the other side and exhibits a conserved GABARAP domain. It functions in the formation of autophagosomal membranes. The transient conjugation of ATG8 to the autophagosomal membrane through a ubiquitin-like conjugation system is essential for autophagy in eukaryotes. Autophagy is induced upon nutrient depletion or rapamycin treatment and leads to the response of more than 30 autophagy-related (ATG) genes known so far, including ATG8.

References
  • Ohsumi Y, et al. (2004) The crystal structure of microtubule-associated protein light chain 3, a mammalian homologue of Saccharomyces cerevisiae Atg8. Genes Cells. 9(7):611-8.
  • Geng J, et al. (2008) The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. 'Protein modifications: beyond the usual suspects' review series. EMBO Rep. 9(9):859-644.
  • Suzuki NN, et al. (2005) The crystal structure of plant ATG12 and its biological implication in autophagy. Autophagy. 1(2):119-126.
  • Size / Price
    Catalog: MG52711-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"