Quick Order

Mouse CLEC1B ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CLEC1B cDNA Clone Product Information
Gene_bank_ref_id:NM_019985.2
RefSeq ORF Size:690bp
cDNA Description:Full length Clone DNA of Mus musculus C-type lectin domain family 1, member b with C terminal His tag.
Gene Synonym:Clec2, Clec-2, mCLEC-2, AI465458, 1810061I13Rik, Clec1b
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

CLEC1B, also known as CLEC2, is a C-type lectin-like receptor expressed in myeloid cells and NK cells. Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 and NKG2D, that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 acts as a receptor for the platelet-aggregating snake venom protein rhodocytin. Rhodocytin binding leads to tyrosine phosphorylation and this promotes the binding of spleen tyrosine kinase (Syk) and initiation of downstream tyrosine phosphorylation events and activation of PLC-gamma-2. CLEC2 contains 1 C-type lectin domain and is expressed preferentially in the liver. It acts as an attachment factor for human immunodeficiency virus type 1 (HIV-1) and facilitates its capture by platelets.

References
  • Suzuki-Inoue K, et al. (2007) Involvement of the snake toxin receptor CLEC-2, in podoplanin-mediated platelet activation, by cancer cells. J Biol Chem. 282(36):25993-6001.
  • Watson AA, et al. (2007) The crystal structure and mutational binding analysis of the extracellular domain of the platelet-activating receptor CLEC-2. J Biol Chem. 282(5):3165-72.
  • Chaipan C, et al. (2006) DC-SIGN and CLEC-2 mediate human immunodeficiency virus type 1 capture by platelets. J Virol. 80(18):8951-60.
  • Size / Price
    Catalog: MG50306-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"