After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse IFNL3 / IL28B Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IFNL3cDNA Clone Product Information
cDNA Size:582
cDNA Description:ORF Clone of Mus musculus interferon lambda 3 DNA.
Gene Synonym:Il28, IFL-1, Il28b, IL-28B, INF-alpha, INF-lambda
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

IL-10 Family & Receptor Related Products

Interleukin-28B (IL-28B) also known as Interferon lambda-3 and IFN-lambda-3, belongs to the type III interferon family of cytokines and are highly similar to IL-29. IL-28B belongs to the newly described interferon lambda (IFNλ) family of cytokines. IL-28B is a cytokine with immunomodulatory activity. It functions in Up-regulating MHC class I antigen expression. IL-28B displays potent antiviral activity and antitumor activity. This cytokine serves as ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IL28RA. The ligand/receptor complex seems to signal through the Jak-STAT pathway. IL-28B, like IL-12, is capable of robustly enhancing adaptive immunity. Moreover, we describe for the first time how IL-28B reduces regulatory T-cell populations during DNA vaccination, whereas IL-12 increases this cellular subset. We also show that IL-28B, unlike IL-12, is able to increase the percentage of splenic CD8+ T cells in vaccinated animals, and that these cells are more granular and have higher antigen-specific cytolytic degranulation compared with cells taken from animals that received IL-12 as an adjuvant.

  • Ge D, et al.. (2009) Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 461(7262): 399-401.
  • Morrow MP, et al.. (2009) Comparative ability of IL-12 and IL-28B to regulate Treg populations and enhance adaptive cellular immunity. Blood. 113(23): 5868-77.
  • Sheppard P, et al.. (2003) IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol. 4(1): 63-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items