Quick Order

Human RFK ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RFK cDNA Clone Product Information
Gene_bank_ref_id:BC007069.1
RefSeq ORF Size:489bp
cDNA Description:Full length Clone DNA of Homo sapiens riboflavin kinase with N terminal HA tag.
Gene Synonym:RIFK, RP11-422N19.2
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Flavokinase is a member of the transferases family, specifically those transferring phosphorus-containing groups (phosphotransferases) with an alcohol group as acceptor. Flavokinase is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis. It has been proposed that TNF, through the activation of the flavokinase gene, enhances the incorporation of FAD in NADPH oxidase enzymes, which is a critical step for the assembly and activation of NADPH oxidase.

References
  • Hirano G, et al. (2011) Involvement of riboflavin kinase expression in cellular sensitivity against cisplatin. Int J Oncol. 38(4):893-902.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Size / Price
    Catalog: HG13881-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"