Quick Order

Human MMP-7 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MMP7 cDNA Clone Product Information
RefSeq ORF Size:804bp
cDNA Description:Full length Clone DNA of Homo sapiens matrix metallopeptidase 7 (matrilysin, uterine) with Flag tag.
Gene Synonym:MMP-7, MPSL1, PUMP-1
Restriction Site:KpnI + XbaI (5.4kb + 0.85kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological and pathological processes such as morphogenesis, differentiation, angiogenesis, tissue remodeling, and tumor invasion. MMPs are synthesized as pro-enzymes and converted to active form by extracellular proteinases. MMP7, also referred to as matrilysin, is the smallest member of the MMP family and differs from other MMP members in that it lacks the C-terminal hemopexin-like domain. MMP7 is produced primarily by mucosal epithelia, and is capable of degrading various ECM proteins including proteoglycans, fibronectin, elastin and casein. This enzyme serves essential functions in both innate defense and wound healing, and appears to be one of the most important MMPs in human colon cancers. It has been reported that MMP7 contributes to tumor malignancy probably by cleaving cell surface proteins such as Fas ligand, degradation of IgG or inducing E-cadherin-mediated cell aggregation. In addition, matrilysin is also identified as a mediator of pulmonary fibrosis and a potential therapeutic target.

Size / Price
Catalog: HG10277-M-F
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions