Quick Order

Text Size:AAA

Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FKBP1A cDNA Clone Product Information
RefSeq ORF Size:327bp
cDNA Description:Full length Clone DNA of Homo sapiens FK506 binding protein 1A, 12kDa, transcript variant 12B with Flag tag.
Gene Synonym:FKBP12, RP11-314N13.2, FKBP-12, FKBP1, FKBP12C, PKC12, PKCI2, PPIASE
Restriction Site:KpnI + XhoI (5.4kb + 0.38kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, Flag tag on other vectors
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-GFPSpark tagHG10268-ACG$325
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10268-ACR$325
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-GFPSpark tagHG10268-ANG$325
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10268-ANR$325
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-Flag tagHG10268-CF$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-His tagHG10268-CH$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-Myc tagHG10268-CM$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, C-HA tagHG10268-CY$295
Human FKBP1A / FKBP12 transcript variant 12B Gene cDNA clone plasmidHG10268-M$95
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, Flag tagHG10268-M-F$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-Flag tagHG10268-NF$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-His tagHG10268-NH$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-Myc tagHG10268-NM$295
Human FKBP1A / FKBP12 transcript variant 12B ORF mammalian expression plasmid, N-HA tagHG10268-NY$295
Human FKBP1A / FKBP12 transcript variant 12B natural ORF mammalian expression plasmidHG10268-UT$295
 Learn more about expression Vectors
Product nameProduct name

FK506 binding protein 12 (FKBP12), also known as FKBP1, along with cyclophilin, are two major members of the immunophilin protein family who serve as receptors for the immunosuppressant drugs cyclosporin A and FK506. As a conserved molecules in many eukaryotes, FKBP12 has been characterized as a peptidyl-prolyl isomerase that catalyzes the transition between cis- and trans-proline residues, and is involved in several biochemical processes including protein folding, receptor signaling, protein trafficking and transcription. FKBP12 has attracted immense attention and its role in mediating the immunosuppressive functions. FKBP12 serves a dual role as a peptidyl-prolyl cis-trans isomerase and as a modulator of several cell signaling pathways. In one such a role, FKBP12 interacts with and regulates the functional state of the ryanodine Ca2+ channel receptor by altering protein conformation and coordinating multi-protein complex formation. Another physiological role of FKBP12 is an interactor and a regulator of the type I serine/threonine kinase receptors of TGF-beta superfamily. Current data, derived from detailed biochemical studies as well as from functional studies in various systems, suggest that FKBP12 functions as a "guardian" for the type I receptors to prevent them from leaky signaling under sub-optimal ligand concentrations, thereby providing a molecular "gradient reader" for TGF-beta family morphogens. This aspect of FKBP12 function may be critical for cellular responsiveness to morphogenetic gradients of the TGF-beta family members during early development, serving to assure the translation of different ligand concentrations into different signaling readouts. In addition, FKBP12 may be involved in neuronal or astrocytic cytoskeletal organization and in the abnormal metabolism of tau protein in Alzheimer's disease (AD) damaged neurons.

  • Wang T, et al. (2004) The immunophilin FKBP12: a molecular guardian of the TGF-beta family type I receptors. Front Biosci. 9: 619-31.
  • Sugata H, et al. (2009) A peptidyl-prolyl isomerase, FKBP12, accumulates in Alzheimer neurofibrillary tangles. Neurosci Lett. 459(2): 96-9.
  • Brath U, et al. (2009) Differential responses of the backbone and side-chain conformational dynamics in FKBP12 upon binding the transition-state analog FK506: implications for transition-state stabilization and target protein recognition. J Mol Biol. 387(1): 233-44.
  • Scaramello CB, et al.. (2009) FKBP12 depletion leads to loss of sarcoplasmic reticulum Ca(2+) stores in rat vas deferens. J Pharmacol Sci. 109(2): 185-92.
  • Size / Price
    Catalog: HG10268-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions