After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human FCER2 / CD23 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FCER2 cDNA Clone Product Information
RefSeq ORF Size:966bp
cDNA Description:Full length Clone DNA of Homo sapiens Fc fragment of IgE, low affinity II, receptor for (FCER2) with Flag tag.
Gene Synonym:FCER2, CD23, FCE2, CD23A, IGEBF, CLEC4J
Restriction Site:KpnI + XhoI (5.4kb + 1.02kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 60 T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Fc fragment of IgE, low affinity II, receptor for (CD23) or CD23 antigen is a member of the cluster of differentiation family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. Physiologically, CD molecules can act in numerous ways, often acting as receptors or ligands (the molecule that activates a receptor) important to the cell. A signal cascade is usually initiated, altering the behavior of the cell (see cell signaling). Some CD proteins do not play a role in cell signaling, but have other functions, such as cell adhesion. CD23/FCER2 is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Increased levels of soluble CD23/FCER2 cause the recruitment of non-sensitised B-cells in the presentation of antigen peptides to allergen-specific B-cells, therefore increasing the production of allergen specific IgE. IgE, in turn, is known to upregulate the cellular expression of CD23 and Fc epsilon RI (high-affinity IgE receptor).

  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature. 358(6386): 505-7.
  • Punnonen J, et al. (1993) Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl Acad Sci U S A. 90(8): 3730-4.
  • Yu P, et al. (1994) Negative feedback regulation of IgE synthesis by murine CD23. Nature. 369(6483): 753-6.
  • Size / Price
    Catalog: HG10261-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions