Quick Order

Mouse SLAMF6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SLAMF6cDNA Clone Product Information
cDNA Size:996
cDNA Description:ORF Clone of Mus musculus SLAM family member 6 DNA.
Gene Synonym:KAL1, NTBA, KAL1b, Ly108, NTB-A, SF2000, Slamf6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

SLAM family member 6, also known as Activating NK receptor, NK-T-B-antigen, NTB-A, SLAMF6, KALI and Ly108, is a single-pass type I membrane protein which belongs to the CD2 subfamily of the immunoglobulin superfamily. SLAMF6 / Ly108 contains one Ig-like (immunoglobulin-like) domain. It is expressed by all (resting and activated) natural killer cells (NK), T- and B-lymphocytes. SLAMF6 / Ly108 triggers cytolytic activity only in natural killer cells (NK) expressing high surface densities of natural cytotoxicity receptors. SLAMF6 / Ly108 is a homodimer. It interacts with PTN6 and, upon phosphorylation, with PTN11 and SH2D1A/SAP. SLAMF6 / Ly108 undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It may function as a coreceptor in the process of NK cell activation. SLAMF6 / Ly108 can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients.

  • Gray CW. et al., 2000, Eur J Biochem. 267 (18): 5699-710.
  • Bottino C. et al., 2001, J Exp Med. 194 (3): 235-46.
  • Valdez PA. et al., 2004, J Biol Chem. 279 (18): 18662-9.
  • Claus M. et al., 2007, Front Biosci. 13: 956-65.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items