Quick Order

Mouse ACP5 / TRAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACP5cDNA Clone Product Information
cDNA Size:984
cDNA Description:ORF Clone of Mus musculus acid phosphatase 5, tartrate resistant DNA.
Gene Synonym:TRAP, TRACP, Acp5
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme expressed in mammals. TRACP is associated with osteoblast migration to bone resorption sites, and, once there, TRACP is believed to initiate osteoblast differentiation, activation, and proliferation. TRACP once considered to be just a histochemical marker of osteoclasts is now recognised to be a molecule of widespread occurrence with functions in both the skeleton and the immune system. Two forms of TRACP circulate in human blood, TRACP 5a derived from macrophages and dendritic cells, and TRACP-5b derived from osteoclasts. Recent data have demonstrated the utility of TRACP-5b as a marker of osteoclast number and bone resorption, and serum TRACP-5a as a marker of inflammatory conditions. TRACP is expressed by osteoclasts, macrophages, dendritic cells and a number of other cell types. It has a critical role in many biological processes including skeletal development, collagen synthesis and degradation, the mineralisation of bone, cytokine production by macrophages and dendritic cells, macrophage recruitment, dendritic cell maturation and a role in the development of Th1 responses.

  • Hayman AR. (2008) Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41(3): 218-23.
  • Halleen JM, et al. (2006) Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of bone resorption. Clin Lab. 52(9-10): 499-509.
  • Mochizuki Y. (2006) Bone and bone related biochemical examinations. Bone and collagen related metabolites. Tartrate-resistant acid phosphatase (TRACP). Clin Calcium. 16(6): 948-55.
  • Lamp EC, et al. (2000) Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma. 39(5-6): 477-84.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items