Quick Order

Mouse CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC6AcDNA Clone Product Information
Gene_bank_ref_id:NM_020001.1
cDNA Size:630
cDNA Description:ORF Clone of Mus musculus C-type lectin domain family 4, member n DNA.
Gene Synonym:Clecsf10, dectin-2, Clec4n
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse CLEC6A / CLEC4N / Dectin-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name
Background

C-type lectin domain family 4 member N (CLEC4N), also known as Dectin-2, is a C-type lectin expressed by dendritic cells (DCs) and macrophages. Members of the C-type lectin domain (CTLD) superfamily are metazoan proteins functionally important in glycoprotein metabolism, mechanisms of multicellular integration and immunity. They share a common fold and are involved in a variety of functions, such as generalized defense mechanisms against foreign agents, discrimination between healthy and pathogen-infected cells, and endocytosis and blood coagulation. Genome-level studies on human, elegans and melanogaster demonstrated almost complete divergence among invertebrate and mammalian families of CTLD-containing proteins (CTLDcps). The vertebrate CTLDcp family was essentially formed early in vertebrate evolution and is completely different from the invertebrate families. The composition of the CTLDcp superfamily in fish and mammals suggests that large scale duplication events played an important role in the evolution of vertebrates. Dectin-2 is important in host defense against C. albicans by inducing Th17 cell differentiation. Dectin-2 constitutes a major fungal pattern recognition receptor (PRR) that can couple to the Syk-CARD9 innate signaling pathway to activate DCs and regulate adaptive immune responses to fungal infection.

References
  • Robinson MJ, et al. (2009) Dectin-2 is a Syk-coupled pattern recognition receptor crucial for Th17 responses to fungal infection. J Exp Med. 206(9): 2037-51.
  • Saijo S, et al. (2010) Dectin-2 recognition of alpha-mannans and induction of Th17 cell differentiation is essential for host defense against Candida albicans. Immunity. 32(5): 681-91.
  • Size / Price
    Catalog:MG50267-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"