Quick Order

Text Size:AAA

Human C7 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human C7 cDNA Clone Product Information
Gene_bank_ref_id:BC063851
RefSeq ORF Size:2532bp
cDNA Description:Full length Clone DNA of Homo sapiens complement component 7 with N terminal HA tag.
Gene Synonym:C7
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Complement component 7 is a component of the complement system. It belongs to the complement C6/C7/C8/C9 family. It contains 1 EGF-like domain, 1 LDL-receptor class A domain, 1 MACPF domain, 2 Sushi (CCP/SCR) domains and 2 TSP type-1 domains. Complement component 7 serves as a membrane anchor. It participates in the formation of Membrane Attack Complex (MAC). People with C7 deficiency are prone to bacterial infection. It is a constituent of MAC that plays a key role in the innate and adaptive immune response by forming pores in the plasma membrane of target cells. Defects in C7 are a cause of complement component 7 deficiency (C7D). A rare defect of the complement classical pathway associated with susceptibility to severe recurrent infections, predominantly by Neisseria gonorrhoeae or Neisseria meningitidis.

References
  • Bossi F, et al. (2009) C7 is expressed on endothelial cells as a trap for the assembling terminal complement complex and may exert anti-inflammatory function. Blood. 113(15):3640-8.
  • Kuijpers TW, et al. (2010) Complement factor 7 gene mutations in relation to meningococcal infection and clinical recurrence of meningococcal disease. Mol Immunol. 47(4):671-7.
  • Thomas AD, et al. (2012) Characterization of a large genomic deletion in four Irish families with C7 deficiency. Mol Immunol. 50(1-2):57-9.
  • Size / Price
    Catalog: HG13848-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"