Quick Order

Human EPHA1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EPHA1 cDNA Clone Product Information
Gene_bank_ref_id:NM_005232.4
RefSeq ORF Size:2931bp
cDNA Description:Full length Clone DNA of Homo sapiens EPH receptor A1 with N terminal His tag.
Gene Synonym:EPH, EPHT, EPHT1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (Fc Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Mouse EphA3 Protein (aa 569-984)Rat EphA3 Protein (Fc Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK ProteinHuman EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 ProteinHuman Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB2 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human EphB6 / EphB6 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA4 Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinHuman EphB1 / EPHT2 Protein (His Tag)Human EphA4 Protein (His & Fc Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphA3 Protein (His Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Rat EphA3 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Rhesus Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Rat EphA4 Protein (His Tag)Rhesus EphA4 Protein (Fc Tag)Rat EphA4 Protein (Fc Tag)Rhesus Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Human EphA3 Protein (His Tag)Rhesus EphA4 Protein (His Tag)Human EphB2 / Hek5 ProteinRat EphA7 / EHK3 Protein (His Tag)Human EphA2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinRhesus EphB1 / EPHT2 Protein (Fc Tag)Mouse EphA3 Protein (aa 569-984, His & GST Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)Rhesus EphB1 / EPHT2 Protein (His Tag)Mouse EphA3 Protein (Fc Tag)Mouse EphB2 / Hek5 Protein (His Tag)Rat EphA7 / Eph Receptor A7 Protein (Fc Tag)
Background

EPHA1 or EPH receptor A1 belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. An important role of Eph receptors and their ligands ephrins is to mediate cell-contact-dependent repulsion. Eph receptors and ephrins also act at boundaries to channel neuronal growth cones along specific pathways, restrict the migration of neural crest cells, and via bidirectional signaling prevent intermingling between hindbrain segments. Eph receptors and ephrins can also trigger an adhesive response of endothelial cells and are required for the remodeling of blood vessels. Eph receptors and ephrins have emerged as key regulators of the repulsion and adhesion of cells that underlie the establishment, maintainence, and remodeling of patterns of cellular organization. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps.

References
  • Flanagan JG, et al. (1998) THE EPHRINS AND EPH RECEPTORS IN NEURAL DEVELOPMENT. Annual Review of Neuroscience. 21: 309-45.
  • Wilkinson DG (2000) Eph receptors and ephrins: Regulators of guidance and assembly. International Review of Cytology. 196: 177-244.
  • Zhou R. (1998) The Eph family receptors and ligands. Pharmacol. 77 (3): 151-81.
  • Size / Price
    Catalog: HG15789-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"