After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse IGFBP4 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse IGFBP4 cDNA Clone Product Information
Gene_bank_ref_id:NM_010517.3
RefSeq ORF Size:765bp
cDNA Description:Full length Clone DNA of Mus musculus insulin-like growth factor binding protein 4 with C terminal His tag.
Gene Synonym:Deb2, IGFBP-4, AI875747, Igfbp4
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Background

Insulin-like growth factor binding protein 4 (IGFBP-4) is a 24-kDa protein that binds insulin-like growth factor 1 (IGF-1) and IGF-2 with high affinity and inhibits IGF action in vitro. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGF-binding protein-4 (IGFBP-4) inhibits IGF-I action in vitro and is the most abundant IGFBP in the rodent arterial wall. Expression of IGFBP-4 mRNA in nontransgenic littermates was maximal in liver and kidney. IGFBP-4 is a functional antagonist of IGF-I action on SMC. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

References
  • Wang J, et al. (1998) Overexpression of insulin-like growth factor-binding protein-4 (IGFBP-4) in smooth muscle cells of transgenic mice through a smooth muscle alpha-actin-IGFBP-4 fusion gene induces smooth muscle hypoplasia. Endocrinology. 139(5): 2605-14.
  • Chernausek SD, et al. (1995) Proteolytic cleavage of insulin-like growth factor binding protein 4 (IGFBP-4). Localization of cleavage site to non-homologous region of native IGFBP-4. J Biol Chem. 1995 May 12;270(19):11377-82.
  • Size / Price
    Catalog: MG50250-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"