Quick Order

Mouse DKK3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse DKK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_015814.2
RefSeq ORF Size:1050bp
cDNA Description:Full length Clone DNA of Mus musculus dickkopf homolog 3 (Xenopus laevis) with C terminal His tag.
Gene Synonym:C87148, AW061014, Dkk3
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

DKK3 (dickkopf related protein 3) is a member of the dickkopf-related family consisting of DKK1, DKK2, DKK3 and DKK4. It is a secreted protein, and also known as REIC (Reduced Expansion in Immortalized Cells). The DKK3 protein is proposed to function as a secreted tumor suppressor since it is downregulated in a number of cancer cells and prostate cancer tissue and may be a promising candidate molecule for therapeutic interference. DKK3 protein is also a negative regulator of beta-catenin and its downregulation contribute to an activation of the beta-catenin signaling pathway.

References
  • Yue W, et al., 2008. Downregulation of Dkk3 activates beta-catenin/TCF-4 signaling in lung cancer. Carcinogenesis, 29 (1): 84-92.
  • Ding Z, et al., 2009. Promoter methylation and mRNA expression of DKK3 and WIF-1 in hepatocellular carcinoma. World J Gastroenterol, 15 (21):2595-601.
  • Size / Price
    Catalog: MG50247-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"