After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CNDP2cDNA Clone Product Information
Gene_bank_ref_id:NM_023149.2
cDNA Size:1428
cDNA Description:ORF Clone of Mus musculus CNDP dipeptidase 2 (metallopeptidase M20 family) DNA.
Gene Synonym:Cn2, Pep1, Dip-2, Pep-1, C76600, 0610010E05Rik, Cndp2
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name
Background

Mouse cytosolic non-specific dipeptidase, also known as CNDP dipeptidase 2, Glutamate carboxypeptidase-like protein 1, Peptidase A, CNDP2 and CN2, is a cytoplasm protein which belongs to the peptidase M20A family. CNDP2 / CPGL is a cytosolic enzyme that can hydrolyze carnosine to yield l-histidine and beta-alanine. CNDP2 / CPGL hydrolyzes a variety of dipeptides including L-carnosine but has a strong preference for Cys-Gly. It may be play a role as tumor suppressor in hepatocellular carcinoma (HCC) cells. Isoform 1 of CNDP2 / CPGL is ubiquitously expressed with higher levels in kidney and liver (at protein level). Isoform 2 of CNDP2 / CPGL is expressed in fetal tissues, it is only expressed in adult liver and placental tissues. CNDP2 / CPGL is highly expressed in the histaminergic neurons in the tuberomammillary nucleus, implying that it may supply histidine to histaminergic neurons for histamine synthesis.

References
  • Bakker,SJ. et al., 2008, Diabetes  57 (12):e16; author reply e17. 
  • Wanic, K. et al., 2008, Diabetes  57 (9): 2547-51.
  • McDonough,CW. et al., 2009, Hum Genet 126 (2): 265-75.
  • Kaur,H. et al., 2009, J Biol Chem. 284 (21):14493-502.
  • Size / Price
    Catalog:MG50246-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"