After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse SDF2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SDF2 cDNA Clone Product Information
Gene_bank_ref_id:NM_009143.2
RefSeq ORF Size:636bp
cDNA Description:Full length Clone DNA of Mus musculus stromal cell derived factor 2 with C terminal His tag.
Gene Synonym:AI853825, MGC107120, Sdf2
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Stromal derived factors (SDFs) are a loosely defined group of molecules that are generated by stromal cells. Two of the stromal derived factors, SDF-1 and SDF-4 belong to the chemokine family. Other SDFs, such as SDF-2 and SDF-5 are not well defined and their biological functions are less known. SDF-2 is first isolated from the mouse stromal cell line ST2 as a secretory protein. The amino acid sequence deduced from the murine clone and the human homolog are conserved more than 92 %, and the aa sequence of SDF-2 shows similarity to those of yeast dolichyl phosphate-D-mannose, protein mannosyltransferases. SDF-1 and its receptor are strongly indicated in the progression of various cancers including breast cancer. SDF-2, SDF2-L1, SDF-4, and SDF-5 are ubiquitously expressed in various cancer cell lines and SDF-2, SDF-4 and SDF-5 are expressed in mammary tissues. These SDFs have prognostic value and warrant further investigation in their biological functions and clinical value.

References
  • Hamada,T.etal.,1996,Gene.176(1-2):211-214.
  • Anjard,C.etal.,1998,Development.125(20):4067-4075.
  • Kang,H.etal.,2009,Int J Oncol.35(1):205-211. 
  • Size / Price
    Catalog: MG50241-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"