After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse F11 / FXI Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
F11cDNA Clone Product Information
Gene_bank_ref_id:NM_028066.1
cDNA Size:1875
cDNA Description:ORF Clone of Mus musculus coagulation factor XI DNA.
Gene Synonym:FXI, Cf11, AI503996, 1600027G01Rik, F11
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Factor XI (plasma thromboplastin antecedent) is a plasma glycoprotein, and a zymogen acting as a serine protease which participates in blood coagulation as a catalyst in the conversion of factor IX to factor IXa in the presence of calcium ions. It is an unusual dimeric protease, with structural features that distinguish it from vitamin K-dependent coagulation proteases. The factor XI is synthesized in the liver as a single polypeptide chain with a molecular weight estimated between 125 ~160 kDa and then is processed into a disulfide-bond linked homodimer. FXI is a homodimer, with each subunit containing four apple domains and a protease domain. The apple domains form a disk structure with binding sites for platelets, high molecular weight kininogen, and the substrate factor IX (FIX). FXI is converted to the active protease FXIa by cleavage of the Arg369-Ile370 bond on each subunit. After the activation reaction, Factor XIa is composed of two heavy and two light chains held together by three disulfide bonds. The heavy chains are derived from the amino termini of the zymogen and responsible for the binding of factor XI to high molecular weight kininogen and for the activation of factor IX, while the light chain contains the catalytic portion of the enzyme and is homologous to the trypsin family of serine proteases. FXI deficiency is a disorder characterized by a mild or no bleeding tendency. Severe FXI deficiency is an injury-related bleeding disorder common in Ashkenazi Jews and rare worldwide.

References
  • Gailani D, et al. (2009) Structural and functional features of factor XI. J Thromb Haemost. 7 Suppl 1: 75-8.
  • Duga S, et al. (2009) Factor XI Deficiency. Semin Thromb Hemost. 35(4): 416-25.
  • Emsley J, et al. (2010) Structure and function of factor XI. Blood. 115(13): 2569-77.
  • Size / Price
    Catalog:MG50237-CH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"