Quick Order

Mouse SERPINF1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINF1cDNA Clone Product Information
Gene_bank_ref_id:NM_011340.3
cDNA Size:1254
cDNA Description:ORF Clone of Mus musculus serine (or cysteine) peptidase inhibitor, clade F, member 1 DNA.
Gene Synonym:Pedf, Sdf3, EPC-1, Pedfl, AI195227, Serpinf1
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Pigment epithelium-derived factor, also known as PEDF, Serpin F1, and SERPINF1, is a multiple functional protein which has both anti-angiogenic activity and neurotrophic activity at the same time. PEDF is a secreted glycoprotein that belongs to the noninhibitory serpin. It has an alpha/beta core serine-protease inhibitor domain, three major beta-sheets, and ten alpha-helices. PEDF does not inhibit either serine or cysteine proteinases. PEDF exerts diverse physiological activities including anti-angiogenesis, anti-vasopermeability, anti-tumor, and neurotrophic activities. PEDF acts via multiple high affinity ligands and cell receptors. It has been described as a natural angiogenesis inhibitor with neurotrophic and immune-modulation properties. PEDF induces macrophages apoptosis and necrosis through the activation of peroxisome proliferator-activated receptor-gamma by which PEDF could modulate inflammatory reactions in septic shock. It balances angiogenesis in the eye and blocks tumor progression.

References
  • Ren, JG. et al., 2005, Med Hypotheses. 64 (1): 74-8.
  • Filleur, S. et al., 2009. J Cell Biochem. 106 (5): 769-75.
  • Kawaguchi, T. et al., 2010, Curr Mol Med. 10 (3): 302-11.
  • Yamagishi, SI. et al., 2010, Curr Mol Med. 10 (3): 284-91.
  • Nakamura, T. et al., 2010, Curr Mol Med. 10 (3): 312-6.
  • Size / Price
    Catalog:MG50235-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"