Quick Order

Text Size:AAA

Human PSG6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PSG6cDNA Clone Product Information
Gene_bank_ref_id:BC020652
cDNA Size:1275
cDNA Description:ORF Clone of Homo sapiens pregnancy specific beta-1-glycoprotein 6 DNA.
Gene Synonym:PSBG-10, PSBG-12, PSBG-6, PSG10, PSG6
Species:Human
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-HA
Vector Size 6146bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-HA (suitable for secretary and membane protein expession) Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

PSG6 is a pregnancy-specific glycoprotein(PSG). PSGs are secreted proteins which are produced by the rodent and primate placenta and play a critical role in pregnancy success. The levels of PSGs are highest during the third trimester of pregnancy, a time marked by the most profound suppression of MS disease attacks. PSGs regulate T-cell function. The regulation of T-cell function during pregnancy is likely the result of significant hormonal changes and may well involve immunoregulatory proteins derived from the placenta. Pregnancy specific glycoproteins (PSGs) are the most abundant placentally derived glycoproteins in the maternal serum. PSG1, PSG6, PSG6N, and PSG11 induce dose-dependent secretion of anti-inflammatory cytokines by human monocytes. Human and murine PSGs exhibit cross-species activity.

References
  • Teglund S, et al. (1995) Characterization of cDNA encoding novel pregnancy-specific glycoprotein variants. Biochem Biophys Res Commun. 211(2):656-64.
  • Grimwood J, et al.. (2004) The DNA sequence and biology of human chromosome 19. Nature. 428(6982):529-35.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Size / Price
    Catalog:HG13808-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"