After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KIRREL ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KIRREL cDNA Clone Product Information
NCBI RefSeq:BC109192
RefSeq ORF Size:2274bp
cDNA Description:Full length Clone DNA of Homo sapiens kin of IRRE like (Drosophila) with N terminal His tag.
Gene Synonym:NEPH1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

NEPH1 (KIRREL1) belongs to a family of three closely related transmembrane proteins of the Ig superfamily with a structure similar to that of nephrin. All three Neph proteins share a conserved podocin-binding motif; mutation of a centrally located tyrosine residue dramatically lowers the affinity of Neph1 for podocin. Neph1 triggers AP-1 activation similarly to nephrin but requires the presence of Tec family kinases for efficient transactivation. Neph1 consists of a signal peptide, five Ig-like C2-type domains with the middle domain overlapping with a PKD-like domain, an RGD sequence, a transmembrane domain and a cytoplasmic tail, which is expressed in slit diaphragm domains of podocytes and in vertebrate and invertebrate nervous systems. Neph1 is abundantly expressed in the kidney, specifically expressed in podocytes of kidney glomeruli, and plays a significant role in the normal development and function of the glomerular permeability. Neph1 interacts with nephrin in vitro and in vivo, and able to stimulate transcriptional activation in a model system, such as the activation the transcription factor AP-1 via the stimulation of a MAPK module. Neph1 is crucial for the integrity of the slit diaphragm, as Neph1 gene knockout mice results in effacement of glomerular podocytes, heavy proteinuria, and early postnatal death.

References
  • Sellin L, et al. (2003) NEPH1 defines a novel family of podocin interacting proteins. FASEB J. 17(1): 115-7.
  • Kim EY, et al. (2009) Neph1 regulates steady-state surface expression of Slo1 Ca(2+)-activated K(+) channels: different effects in embryonic neurons and podocytes. Am J Physiol Cell Physiol. 297(6): C1379-88.
  • Size / Price
    Catalog: HG15752-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"