Quick Order

Text Size:AAA

Mouse ALK-1 / ACVRL1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ACVRL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_009612.2
RefSeq ORF Size:1509bp
cDNA Description:Full length Clone DNA of Mus musculus activin A receptor, type I I-like 1 with C terminal His tag.
Gene Synonym:Alk1, Alk-1, Acvrlk1, AI115505, AI427544, Acvrl1
Species:Mouse
Vector:pCMV3-C-His
Plasmid:pCMV3-mACVRL1-His
Restriction Site:HindIII + XbaI (6kb + 1.55kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ACVRL1 Gene Plasmid Map
Mouse ALK-1 / ACVRL1 natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific type I receptor of the TGF-beta (transforming growth factor beta) receptor family of ligands. On ligand binding, a heteromeric receptor complex forms consisting of two type II and two type I transmembrane serine/threonine kinases. ACVRL1 protein is expressed in certain blood vessels of kidney, spleen, heart and intestine, serving as an important role during vascular development. Mutations in ACVRL1 gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2 and vascular disease.

References
  • French Rendu-Osler network,et al. (2004) Molecular screening of ALK1/ACVRL1 and ENG genes in hereditary hemorrhagic telangiectasia in France. Hum Mutat. 23(4): 289-299.
  • Simon M, et al. (2006) Association of a polymorphism of the ACVRL1 gene with sporadic arteriovenous malformations of the central nervous system. J Neurosurg. 104(6): 945-9.
  • Argyriou L, et al. (2006) Novel mutations in the ENG and ACVRL1 genes causing hereditary hemorrhagic teleangiectasia. Int J Mol Med. 17(4):655-9.
  • Size / Price
    Catalog: MG50208-CH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"