Quick Order

Human ARF5 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ARF5 cDNA Clone Product Information
Gene_bank_ref_id:BC003043
RefSeq ORF Size:543bp
cDNA Description:Full length Clone DNA of Homo sapiens ADP-ribosylation factor 5 with C terminal HA tag.
Gene Synonym:ARF5
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ARF5, also known as ADP-ribosylation factor 5, belongs to the small GTPase superfamily, Arf family. Members of this family stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF5 functions as an allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. ARF5 Is involved in protein trafficking. ARF5 may also modulate vesicle budding and uncoating within the Golgi apparatus.

References
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Tsuchiya M. et al., 1991, J Biol Chem. 266 (5): 2772-7.
  • McGuire RE. et al., 1997, Genomics. 41 (3): 481-4.
  • Size / Price
    Catalog: HG14934-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"