Quick Order

Text Size:AAA

Mouse KIRREL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KIRRELcDNA Clone Product Information
cDNA Size:2370
cDNA Description:ORF Clone of Mus musculus kin of IRRE like (Drosophila) DNA.
Gene Synonym:Neph1, Kirrel1, Kirrel
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

NEPH1 (KIRREL1) belongs to a family of three closely related transmembrane proteins of the Ig superfamily with a structure similar to that of nephrin. All three Neph proteins share a conserved podocin-binding motif; mutation of a centrally located tyrosine residue dramatically lowers the affinity of Neph1 for podocin. Neph1 triggers AP-1 activation similarly to nephrin but requires the presence of Tec family kinases for efficient transactivation. Neph1 consists of a signal peptide, five Ig-like C2-type domains with the middle domain overlapping with a PKD-like domain, an RGD sequence, a transmembrane domain and a cytoplasmic tail, which is expressed in slit diaphragm domains of podocytes and in vertebrate and invertebrate nervous systems. Neph1 is abundantly expressed in the kidney, specifically expressed in podocytes of kidney glomeruli, and plays a significant role in the normal development and function of the glomerular permeability. Neph1 interacts with nephrin in vitro and in vivo, and able to stimulate transcriptional activation in a model system, such as the activation the transcription factor AP-1 via the stimulation of a MAPK module. Neph1 is crucial for the integrity of the slit diaphragm, as Neph1 gene knockout mice results in effacement of glomerular podocytes, heavy proteinuria, and early postnatal death.

  • Sellin L, et al. (2003) NEPH1 defines a novel family of podocin interacting proteins. FASEB J. 17(1): 115-7.
  • Kim EY, et al. (2009) Neph1 regulates steady-state surface expression of Slo1 Ca(2+)-activated K(+) channels: different effects in embryonic neurons and podocytes. Am J Physiol Cell Physiol. 297(6): C1379-88.