Quick Order

Mouse HSPA8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HSPA8cDNA Clone Product Information
cDNA Size:1941
cDNA Description:ORF Clone of Mus musculus heat shock protein 8 DNA.
Gene Synonym:Hsc70, Hsc71, Hsc73, Hsp73, Hspa10, 2410008N15Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

HSPA8, also known as HSC70, is a member of the heat shock protein family due to homology with other heat shock proteins. The heat shock protein 70 family is comprised by both heat-inducible and constitutively expressed members. The latter are called heat-shock cognate proteins. HSPA8 belongs to the heat-shock cognate subgroup. Members of the human heat-shock protein multigene family have several highly conserved proteins with structural and functional properties in common, but vary in the extent of their inducibility in response to metabolic stress. HSPA8 is constitutively expressed and performs functions related to normal cellular processes. This protein binds to nascent polypeptides to facilitate correct protein folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Two alternatively spliced variants have been characterized to date. HSPA8 acts as a repressor of transcriptional activation. It inhibits the transcriptional coactivator activity of CITED1 on Smad-mediated transcription. Isoform 2 may function as an endogenous inhibitory regulator of HSC70 by competing the co-chaperones. It also is a ATPase that works with auxilin to remove clathrin coated vesicles. In neurons, synaptojanin is also an important protein involved in vesicle uncoating.

  • Santacruz H, et al. (1997) Molecular characterization of a heat shock cognate cDNA of zebrafish, hsc70, and developmental expression of the corresponding transcripts. Dev Genet. 21:223-33.
  • Harhay G P, et al. (2005) Characterization of 954 bovine full-CDS cDNA sequences. BMC Genomics. 6: 166.
  • Goldfarb S, et al. (2006) Differential effects of Hsc70 and Hsp70 on the intracellular trafficking and functional expression of epithelial sodium channels. Proc Natl Acad Sci. 103(15):5817-22.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items