After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CCL8 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CCL8 cDNA Clone Product Information
Gene_bank_ref_id:NM_021443.2
RefSeq ORF Size:294bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 8 with C terminal His tag.
Gene Synonym:HC14, Mcp2, MCP-2, Scya8, AB023418, 1810063B20Rik, Ccl8
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Background

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 8 (CCL8), also known as monocyte chemoattractant protein 2 (MCP-2), is a small cytokine belonging to the C-C chemokine family. CCL8 functions to activate different immune cells, including mast cells, eosinophils and basophils which are involved in allergic responses, monocytes, and T cells and NK cells which are involved in the inflammatory response. CCL8's ability achieves by binding to different cell surface receptors termed chemokine receptors including CCR1, CCR2B and CCR5. It has been reported that CCL8 is a potent inhibitor of HIV-1 by virtue of its binding to CCR5 which is one of the major co-receptors for HIV-1.

References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28 (5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811–5.
  • Hori T, et al. (2008) CCL8 is a potential molecular candidate for the diagnosis of graft-versus-host disease. Blood. 111 (8): 4403-12.
  • Biber K, et al. (2003) Expression of L-CCR in HEK 293 cells reveals functional responses to CCL2, CCL5, CCL7, and CCL8. Journal of Leukocyte Biology. 74 (2): 243-51.
  •  

    CCL8/MCP-2 related areas, pathways, and other information

    Size / Price
    Catalog: MG50181-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"