Quick Order

Mouse CCL1 / TCA3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CCL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_011329.2
RefSeq ORF Size:279bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 1 with C terminal His tag.
Gene Synonym:I-309, Scya1, Tca-3, BF534335, Ccl1
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Background

CCL1 or chemokine (C-C motif) ligand 1, also known as I-309 or TCA-3, is a member of the chemokine (C-C motif) ligand family. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands (CCL)-1 to 28. I-309/CCL1/TCA-3 interacts with the G protein-linked transmembrane chemokine receptors CCR8, and induces biochemical events that may result in the control of chemotaxis, proliferation, apoptosis and adhesion. It has been demonstrated that I-309/CCL1/TCA-3 displays chemotactic activity for monocytes and other cell types such as NK cells and dendritic cells, but not for neutrophils. Furthermore, as the only known physiological ligand for CCR8, I-309/CCL1/TCA-3 was identified as a potent inhibitor of HIV-1 envelope-mediated cell-cell fusion and virus infection. I-309/CCL1/TCA-3 induce significant levels of LTC4 from elicited eosinophils.

References
  • Miller MD, et al. (1992) The human cytokine I-309 is a monocyte chemoattractant. Proc Natl Acad Sci. 89 (7): 2950-4.
  • Roos RS, et al. (1997) Identification of CCR8, the receptor for the human CC chemokine I-309. J Biol Chem. 272 (28): 17251-4.
  • Oliveira SH, et al. (2002) Increased responsiveness of murine eosinophils to MIP-1beta (CCL4) and TCA-3 (CCL1) is mediated by their specific receptors, CCR5 and CCR8. J Leukoc Biol. 71(6): 1019-25.
  • Size / Price
    Catalog: MG50178-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"