After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GALNT2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GALNT2 cDNA Clone Product Information
Gene_bank_ref_id:BC041120
RefSeq ORF Size:1716bp
cDNA Description:Full length Clone DNA of Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2) with N terminal HA tag.
Gene Synonym:GalNAc-T2, GALNT2
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

GALNT2, also known as GalNAc-T2, is a member of the GalNAc-transferases family. Members of this family transfer an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. GALNT2 may play a role in lipid metabolism. It catalyzes the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. GALNT2 has a broad spectrum of substrates for peptides such as EA2, Muc5AC, Muc1a, Muc1b.

References
  • Bennett EP. et al., 1998, Glycobiology. 8 (6): 547-55.
  • White T. et al., 1995, J Biol Chem. 270 (41): 24156-65.
  • Bennett EP. et al., 1996, J Biol Chem. 271 (29): 17006-12.
  • Holleboom AG. et al., 2011, Cell Metab. 14 (6): 811-8.
  • Size / Price
    Catalog: HG13764-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"