Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SERPINB8 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner.
Mouse SerpinB8, also known as Cytoplasmic antiproteinase 2, Peptidase inhibitor 8, SerpinB8, PI-8, SERPINB8 and CAP2, is a member of the Serpin superfamily. SERPINB8 was broadly expressed. In normal neuroendocrine tissues, strongest SerpinB8 expression was detected in islets of Langerhans of the pancreas. Moderate SerpinB8 expression was observed in neuroendocrine cells of the thyroid, adrenal cortex, colon, and pituitary gland. In the pancreas, SerpinB8 is specifically expressed by insulin-producing beta cells, and can be used as an additional diagnostic immunohistochemical marker. Mouse SerpinB8 distribution alters during kidney regeneration, possibly to control a prohormone convertase involved in inflammation or tissue repair.

References
  • Sumi, Y. et al., 1989, J. Biochem. 106: 703-7.
  • Rawlings, N.D. et al., 2004, Biochem J. 378: 705-16.
  • Gillard, A. et al., 2006, Am J Nephrol. 26 (1): 34-42.
  • Filleur, S. et al., 2009, J Cell Biochem. 106 (5): 769-75.
  • de Koning, P.J. et al., 2009, Pancreas. 38 (4): 461-7.
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"