Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KIAA0101 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

KIAA0101, also known as p15(PAF), is a proliferating cell nuclear antigen-associated factor which interacts with proliferating cell nuclear antigen(PCNA). It was initially isolated in a yeast two-hybrid screen for PCNA binding partners, and was shown to bind PCNA competitively with the cell cycle regulator p21(WAF). KIAA0101 is localized primarily in the nucleus. It shares the conserved PCNA binding motif with several other PCNA binding proteins including CDK inhibitor p21 . KIAA0101 is involved in cell proliferation and plays a role in early tumor recurrence (ETR), and prognosis of hepatocellular carcinoma (HCC). KIAA0101 is expressed predominantly in liver, pancreas and placenta. It cannot be detected in heart or brain. It is highly expressed in a number of tumors, especially esophageal tumors, in anaplastic thyroid carcinomas and in non-small-cell lung cancer lines. Overexpression of KIAA0101 predicts high stage, early tumor recurrence, and poor prognosis of hepatocellular carcinoma. It also may be involved in protection of cells from UV-induced cell death.

  • Yu P, et al. (2001) p15(PAF), a novel PCNA associated factor with increased expression in tumor tissues. Oncogene. 20 (4): 484-9.
  • Simpson F, et al. (2005) The PCNA-associated factor KIAA0101/p15(PAF) binds the potential tumor suppressor product p33ING1b. Exp Cell Res. 312 (1): 73-85.
  • Guo M, et al. (2006) KIAA0101 (OEACT-1), an expressionally down-regulated and growth-inhibitory gene in human hepatocellular carcinoma. BMC Cancer. 6: 109.
  • Nagase T, et al. (1995) Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 2 (1): 37-43.
  • Images
      Recently Viewed Items