Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human S100A13 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.  Protein S100-A13, also known as S100 calcium-binding protein A13, is a member of the S-100 family. It contains two EF-hand domains. S100A13 binds two calcium ions per subunit and one copper ion. Binding of one copper ion does not interfere with calcium binding. S100A13 is required for the copper-dependent stress-induced export of IL1A and FGF1. The calcium-free protein binds to lipid vesicles containing phosphatidylserine, but not to vesicles containing phosphatidylcholine. S100A13 plays a role in the export of proteins that lack a signal peptide and are secreted by an alternative pathway.

  • Mandinova A. et al., 2003, J Cell Sci. 116: 2687-96.
  • Arnesano F. et al., 2005, Angew Chem Int Ed. 44: 6341-4.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Images
      Recently Viewed Items