Quick Order

Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TNFSF10cDNA Clone Product Information
Gene_bank_ref_id:NM_009425.2
cDNA Size:876
cDNA Description:ORF Clone of Mus musculus tumor necrosis factor (ligand) superfamily, member 10 DNA.
Gene Synonym:TL2, Ly81, Trail, APO-2L, AI448571, A330042I21Rik
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50166-ACG$325
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50166-ACR$325
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50166-ANG$325
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50166-CF$295
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50166-CH$295
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50166-CM$295
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50166-CY$295
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone)MG50166-M$95
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedMG50166-M-F$295
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50166-NF$295
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50166-NH$295
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50166-NM$295
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50166-NY$295
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50166-UT$295
 Learn more about expression Vectors
Tumor Necrosis Factor (TNF) & Receptor Related Products
Product nameProduct name
Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human GITR / TNFRSF18 Protein (His Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (ECD, His Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman BLyS / TNFSF13B / BAFF ProteinHuman DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 Protein (His Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinHuman Osteoprotegerin / TNFRSF11B Protein (His Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFSF14 / LIGHT / CD258 Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human TNFSF10 / TRAIL / APO-2L / CD253 ProteinHuman TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 ProteinHuman XEDAR / EDA2R Protein (His Tag)Human TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Mouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinMouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Ferret TNF-alpha / TNFA ProteinCanine TNF-alpha / TNFA / TNFSF1A ProteinCanine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Rat TNF-alpha / TNFA ProteinRat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat TNFSF15 / TL1A Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag) Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Rat LTBR / TNFRSF3 Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat EDAR Protein (Fc Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinCynomolgus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus CD40L / CD154 / TNFSF5 Protein (Fc Tag) Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (His Tag)Cynomolgus TNFSF10 / TRAIL / APO-2L ProteinCynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Cynomolgus / Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human TNFRSF11A Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)
Background

Tumor necrosis factor ligand superfamily member 10 (TNFSF10), also known as TNF-related apoptosis-inducing ligand (TRAIL), Apo-2 ligand, and CD253, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. TNFSF10 / Apo-2L / CD253 functions as a ligand that induces the process of cell death called apoptosis. TNFSF10 / TRAIL shows homology to other members of the tumor necrosis factor superfamily. As one member of the cluster of differentiation system, TNFSF10 / CD253 is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion TNFSF10 / Apo-2L / CD253 / TRAIL binds to several members of TNF receptor superfamily including TNFRSF10A / TRAILR1, TNFRSF10B / TRAILR2, TNFRSF10C / TRAILR3, TNFRSF10D / TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of TNFSF10 / TRAIL may be modulated by binding to the decoy receptors TNFRSF10C / TRAILR3, TNFRSF10D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8 / JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

References
  • Song C, et al. (2005) TRAIL (CD253), a new member of the TNF superfamily. J Biol Regul Homeost Agents. 19(1-2): 73-7.
  • Kuribayashi K, et al. (2008) TNFSF10 (TRAIL), a p53 target gene that mediates p53-dependent cell death. Cancer Biol Ther. 7(12): 2034-8.
  • Wiley SR, et al. (1995) Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity. 3(6): 673-82.
  • Size / Price
    Catalog:MG50166-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"