Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KLRF1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

NKp80, also known as KLRF1, is an activating homodimeric C-type lectin-like receptor which is expressed on nearly all natural killer cells and stimulates their cytoxicity and cytokine release. NKp80 stimulates cytotoxicity upon engagement of its genetically linked ligand: myeloid-specific CTLR activation-induced C-type lectin (AICL). NKp80, but not NKp80 mutated at tyrosine 7 (NKp80/Y7F), is tyrosine phosphorylated. Accordingly, NKp80/Y7F, but not NKp80/Y30F or NKp80/Y37F, failed to induce cytotoxicity. NKp80 phosphopeptides comprising the hemi-ITAM-like sequence surrounding tyrosine 7 bound Lck- and Syk-family kinases; accordingly, cross-linking of NKp80, but not NKp80/Y7F, induced Syk phosphorylation. Moreover, inhibition of Syk kinase, but not ZAP-70 kinase, impaired cytotoxic responses through NKp80. Atypical residues in the hemi-ITAM-like motif of NKp80 cause an altered stoichiometry of phosphorylation but did not substantially affect NK cytotoxicity. Altogether, these results show that NKp80 uses an atypical hemi-ITAM and Syk kinase to trigger cellular cytotoxicity.

References
  • Kuttruff S. et al., 2009, Blood. 113 (2): 358-69.
  • Dennehy KM. et al., 2011, J Immunol. 186 (2): 657-61.
  • Roda-Navarro P. et al., 2000, Eur J Immunol. 30 (2): 568-76.
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"