Quick Order

Mouse PLAUR ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PLAUR cDNA Clone Product Information
Gene_bank_ref_id:NM_011113.3
RefSeq ORF Size:984bp
cDNA Description:Full length Clone DNA of Mus musculus plasminogen activator, urokinase receptor with C terminal His tag.
Gene Synonym:Cd87, uPAR, u-PAR, Plaur
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Urokinase plasminogen activator (uPA) and/or its receptor (uPAR) are essential for metastasis, and overexpression of these molecules is strongly correlated with poor prognosis in a variety of malignant tumours. uPAR and uPA levels in both resected tumor tissue and plasma are of independent prognostic significance for patient survival in several types of human cancer. This system has classically been thought to drive tumor progression by mediating directed extracellular proteolysis on the surface of migrating or invading cells, and intervening with this proteolysis by targeting uPAR has been proposed to represent a novel approach for inhibiting tumor progression. uPAR, also known as PLAUR or CD87, has been implicated in the growth, metastasis, and angiogenesis of several solid and hemotologic malignancies. uPAR is a highly glycosylated, 55-60kDa integral membrane protein linked to the plasma membrane by a glycosylphosphatidylinositol (GPI) anchor. It is part of a cell surface system that also consists of the serine protease uPA and several specific inhibitors (plasminogen activator inhibitors 1 and 2). Additionally, the analysis of CD87 (urokinase-type plasminogen activator receptor - uPAR) expression has a potential role in the diagnostic or prognostic work-up of several hematological malignancies, particularly acute leukemia and multiple myeloma.

References
  • Romer J, et al. (2004) The urokinase receptor as a potential target in cancer therapy. Curr Pharm Des. 10(19): 2359-76.
  • Bn MC, et al. (2004) CD87 (urokinase-type plasminogen activator receptor), function and pathology in hematological disorders: a review. Leukemia. 18(3): 394-400.
  • Pillay V, et al. (2007) The urokinase plasminogen activator receptor as a gene therapy target for cancer. Trends Biotechnol. 25(1): 33-9.
  • Mazar AP. (2008) Urokinase plasminogen activator receptor choreographs multiple ligand interactions: implications for tumor progression and therapy. Clin Cancer Res. 14(18): 5649-55.
  • Size / Price
    Catalog: MG50160-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"