After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PIK3IP1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PIK3IP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_178149.4
RefSeq ORF Size:795bp
cDNA Description:Full length Clone DNA of Mus musculus phosphoinositide-3-kinase interacting protein 1 with N terminal Flag tag.
Gene Synonym:Crkd, Hgfl, RP23-191E3.6, 1500004A08Rik, 5830455E04Rik
Species:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PIK3IP1 contains 1 kringle domain and is a negative regulator of phosphatidylinositol-3-kinase (PI3K), suppresses the development of hepatocellular carcinoma. PI3K is a well-known regulator of cell division, motility, metabolism and survival in most cell types. Proper liver function and development highly depend on intact PI3K signal transduction. Aberrant PI3K pathway signaling in the liver is associated with hepatocellular carcinoma. PI3K signaling is involved in the homeostasis of lipid and glucose metabolism. Activation of the PI3K pathway induces lipogenesis and glycogenesis in the liver, since both Akt overexpressing transgenic mice and PTEN knockout mice develop fatty liver and hypoglycemia. PIK3IP1 overexpression can contribute to glucose homeostasis and fatty deposition.

References
  • He X, et al. (2008) PIK3IP1, a negative regulator of PI3K, suppresses the development of hepatocellular carcinoma. Cancer Res. 68(14):5591-8.
  • Gao P, et al. (2008) Both PIK3IP1 and its novel found splicing isoform, PIK3IP1-v1, are located on cell membrane and induce cell apoptosis. Beijing Da Xue Xue Bao. 40(6):572-7.
  • Zhu Z, et al. (2007) PI3K is negatively regulated by PIK3IP1, a novel p110 interacting protein. Biochem Biophys Res Commun. 358(1):66-72.
  • Size / Price
    Catalog: MG52429-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"