After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse EPO Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EPOcDNA Clone Product Information
cDNA Size:579
cDNA Description:ORF Clone of Mus musculus erythropoietin DNA.
Gene Synonym:Epo
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Erythropoietin is a member of the EPO / TPO family. It is a secreted, glycosylated cytokine composed of four alpha helical bundles. Erythropoietin can be found in the plasma and regulates red cell production by promoting erythroid differentiation and initiating hemoglobin synthesis. It also has neuroprotective activity against a variety of potential brain injuries and antiapoptotic functions in several tissue types. Erythropoietin is the principal hormone involved in the regulation of erythrocyte differentiation and the maintenance of a physiological level of circulating erythrocyte mass. It is produced by kidney or liver of adult mammals and by liver of fetal or neonatal mammals. Genetic variation in erythropoietin is associated with susceptbility to microvascular complications of diabetes type 2. These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. It has a longer circulating half-life in vivo. Erythropoietin is being much misused as a performance-enhancing drug in endurance athletes.

  • Jelkmann W, et al. (2007) Erythropoietin after a century of research: younger than ever. Eur J Haematol. 78 (3):183-205.
  • Miyake T, et al. (1997) Purification of human erythropoietin. J Biol Chem. 252(15):5558-64.
  • Haroon ZA, et al. (2003) A novel role for erythropoietin during fibrin-induced wound-healing response. Am J Pathol. 163(3):993-1000.
  • Siren AL, et al. (2001) Erythropoietin prevents neuronal apoptosis after cerebral ischemia and metabolic stress. Proc Natl Acad Sci. 98(7):4044-9.