After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TGF-beta2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TGFB2 cDNA Clone Product Information
Gene_bank_ref_id:NM_009367.3
RefSeq ORF Size:1245bp
cDNA Description:Full length Clone DNA of Mus musculus transforming growth factor, beta 2 with C terminal His tag.
Gene Synonym:Tgfb-2, BB105277, Tgf-beta2, Tgfb2
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman ALK-2 / ACVR1 Protein (His & Fc Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human TGFBR2 Protein (His & Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human BAMBI / NMA Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinRat Cripto / TDGF1 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Rhesus ACVR1B / ALK-4 Protein (Fc Tag)Mouse BAMBI / NMA Protein (Fc Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rhesus TGFBR2 Protein (Fc Tag)Rhesus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Mouse Smad5 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)
Background

TGF beta 2 (Transforming growth factor beta 2), an extracellular glycosylated protein, which belongs to the TGF-beta family. TGF-beta regulates key mechanisms of tumor development, namely immunosuppression, metastasis, angiogenesis, and proliferation. TGF beta 2 suppression is a promising therapeutic approach for malignant tumor therapy. The signaling pathway of TGF beta 2/Smad plays an important role in the pathological process in posterior capsule opacification (PCO) after cataract surgery. Silencing Smad2 and Smad3 efficiently blocked the effect of TGF beta 2 on cell proliferation, migration, and extracellular matrix production. TGF beta 2 activation of MEKK3/ERK1/2/5 signaling modulates Has2 expression and hyaluronan (HA) production leading to the induction of epithelial to mesenchymal transformation (EMT) events. In addition, the upregulation of the TGF beta 2 level is a common pathological feature of Alzheimer's disease (AD) brains and suggests that it may be closely linked to the development of neuronal death related to AD.

References
  • Schlingensiepen KH, et al. (2006) Targeted tumor therapy with the TGF-beta 2 antisense compound AP 12009. Cytokine Growth Factor Rev. 17(1-2): 129-39.
  • Ghatpande SK, et al. (2010) Transforming growth factor beta2 is negatively regulated by endogenous retinoic acid during early heart morphogenesis. Dev Growth Differ. 52(5): 433-55.
  • Noguchi A, et al. (2010) Transforming growth factor beta2 level is elevated in neurons of Alzheimer's disease brains. Int J Neurosci. 120(3): 168-75.
  • Li J, et al. (2011) Comparative effects of TGF-_2/Smad2 and TGF-_2/Smad3 signaling pathways on proliferation, migration, and extracellular matrix production in a human lens cell line. Exp Eye Res. 92(3): 173-9.
  • Size / Price
    Catalog: MG50153-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"