Quick Order

Mouse CXCL11 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CXCL11 cDNA Clone Product Information
Gene_bank_ref_id:NM_019494.1
RefSeq ORF Size:303bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-X-C motif) ligand 11 with C terminal His tag.
Gene Synonym:IP9, H174, ITAC, b-R1, CXC11, I-TAC, SCYB9B, Scyb11, betaR1, Cxcl11
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Background

I-TAC, also known as CXCL11, is a small cytokine belonging to the CXC chemokine family. It is highly expressed in peripheral blood leukocytes, pancreas and liver, with moderate levels in thymus, spleen and lung and low expression levels were in small intestine, placenta and prostate. The I-TAC chemokine elicits its effects on its target cells by interacting with the cell surface chemokine receptor CXCR3, with a higher affinity than do the other ligands for this receptor, CXCL9 and CXCL10. I-TAC is chemotactic for activated T cells. The CXCL11 gene is located on human chromosome 4 along with many other members of the CXC chemokine family.

References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Rani MR, et al. (2002) Requirement of phosphoinositide 3-kinase and Akt for interferon-beta-mediated induction of the beta-R1 (SCYB11) gene. J Biol Chem. 277(41): 38456-61.
  • Salmaggi A, et al. (2003) Expression and modulation of IFN-gamma-inducible chemokines (IP-10, Mig, and I-TAC) in human brain endothelium and astrocytes: possible relevance for the immune invasion of the central nervous system and the pathogenesis of multiple sclerosis. J Interferon Cytokine Res. 22(6):631-40.
  • Size / Price
    Catalog: MG50151-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"