Quick Order

Text Size:AAA

Human ABCF1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ABCF1 cDNA Clone Product Information
RefSeq ORF Size:2538bp
cDNA Description:Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family F (GCN20), member 1ABCF1 ATP-binding cassette, sub-family F (GCN20), member 1.
Gene Synonym:ABC27, ABC50,
Restriction Site:KpnI + XhoI (5.5kb + 2.54kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10955-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions