Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SDF2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Stromal derived factors (SDFs) are a loosely defined group of molecules that are generated by stromal cells. Two of the stromal derived factors, SDF-1 and SDF-4 belong to the chemokine family. Other SDFs, such as SDF-2 and SDF-5 are not well defined and their biological functions are less known. SDF-2 is first isolated from the mouse stromal cell line ST2 as a secretory protein. The amino acid sequence deduced from the murine clone and the human homolog are conserved more than 92 %, and the aa sequence of SDF-2 shows similarity to those of yeast dolichyl phosphate-D-mannose, protein mannosyltransferases. SDF-1 and its receptor are strongly indicated in the progression of various cancers including breast cancer. SDF-2, SDF2-L1, SDF-4, and SDF-5 are ubiquitously expressed in various cancer cell lines and SDF-2, SDF-4 and SDF-5 are expressed in mammary tissues. These SDFs have prognostic value and warrant further investigation in their biological functions and clinical value.

  • Hamada,T.etal.,1996,Gene.176(1-2):211-214.
  • Anjard,C.etal.,1998,Development.125(20):4067-4075.
  • Kang,H.etal.,2009,Int J Oncol.35(1):205-211. 
  • Images
        Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.