After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human C1QB Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
C1QBcDNA Clone Product Information
Gene_bank_ref_id:NM_000491.3
cDNA Size:762
cDNA Description:ORF Clone of Homo sapiens complement component 1, q subcomponent, B chain DNA.
Gene Synonym:C1QB
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Complement Component 1, q subcomponent (C1q) associates with C1r and C1s in order to yield the first component of the serum complement system. Deficiency of C1q has been associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains: six A-chains, six B-chains, and six C-chains. Southern blot analysis of chromosomal DNA from vertebrate species demonstrated highest similarity between the C1qB genes, followed by C1qC and finally C1qA. Sequence comparison of C1q from three different species have shown that the B chains have the strongest similarity. C1q was already present at embryonic day 14 (E14) and showed little change in abundance through six weeks postnatal. At E16, C1qB mRNA was present at high abundance in putative microglia/macrophages in cortical marginal and intermediate zones, and hippocampal analge.

References
  • Pasinetti GM, et al. (1992) Complement C1qB and C4 mRNAs responses to lesioning in rat brain. Experimental neurology. 118(2): 117-25.
  • Johnson SA, et al. (1994) Expression of complement C1qB and C4 mRNAs during rat brain development. Brain Res Dev Brain Res. 80(1-2): 163-74.
  • Grewal RP,et al. (1999) C1qB and clusterin mRNA increase in association with neurodegeneration in sporadic amyotrophic lateral sclerosis. Neuroscience letters. 271(1): 65-7.
  • Spielman L, et al. (2002) Induction of the complement component C1qB in brain of transgenic mice with neuronal overexpression of human cyclooxygenase-2. Acta neuropathologica. 103(2): 157-62.
  • Size / Price
    Catalog:HG10941-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"