Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human S100A6 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. S100A6 (S100 calcium binding protein A6) is a member of the S100 family of proteins, and functions in prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of S100A6 have been implicated in melanoma.

References
  • Schäfer, B.W. et al., 1996, Trends Biochem. Sci. 21 (4): 134-140.
  • Donato,R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-551.
  • Nowotny, M. et al., 2003, J. Biol. Chem. 278 (29): 26923-26928.
  • Nonaka D, et al., 2008, J. Cutan. Pathol. 35 (11): 1014-1019.
  • Marenholz, I. et al., 2004, Biochem. Biophys. Res. Commun. 322 (4): 1111-22. 
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"