Quick Order

Mouse ROBO4 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ROBO4 cDNA Clone Product Information
Gene_bank_ref_id:NM_028783.2
RefSeq ORF Size:3048bp
cDNA Description:Full length Clone DNA of Mus musculus roundabout homolog 4 (Drosophila) with N terminal Myc tag.
Gene Synonym:AI593217, 1200012D01Rik, Robo4
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Roundabout homolog 4, also known as magic roundabout and ROBO4 is a member of the immunoglobulin superfamily and ROBO family. ROBO4 is specifically expressed in endothelial cells. It is expressed at sites of angiogenesis in different tumor types. ROBO4 contains two fibronectin type-III domains and two Ig-like C2-type (immunoglobulin-like) domains. ROBO4 is the fourth identified member of the roundabout receptor family. It is the only Robo family member expressed in primary endothelial cells and that application of Slit inhibits their migration. ROBO4 is predominantly expressed in embryonic or tumor vascular endothelium and is considered important for vascular development and as a candidate tumor endothelial marker. ROBO4 is a bona fide member of the Robo family and may provide a repulsive cue to migrating endothelial cells during vascular development. ROBO4 is a receptor for Slit proteins, at least for SLIT2, and seems to be involved in angiogenesis and vascular patterning. ROBO4 may mediate the inhibition of primary endothelial cell migration by Slit proteins. Activating ROBO4 may have broad therapeutic application in diseases characterized by excessive angiogenesis and/or vascular leak.

References
  • Huminiecki L., et al., 2002, Genomics 79:547-552.
  • Park,K.W. et al., 2003,Dev Biol. 261 (1):251-67.
  • Yoshikawa,M. et al., 2008, Protein Expr Purif. 61 (1):78-82.
  • Jones,C.A. et al., 2008, Nat Med. 14 (4):448-53.
  • Koch,A.W. et al., 2011, Dev Cell. 20 (1):33-46.
  • Size / Price
    Catalog: MG51081-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"